Namemrsslovacek.weebly.com/uploads/5/8/2/5/58255793/... · 2. Why is protective wear necessary when...

Post on 03-Jul-2020

0 views 0 download

Transcript of Namemrsslovacek.weebly.com/uploads/5/8/2/5/58255793/... · 2. Why is protective wear necessary when...

Name:

Unit 3: DNA Evidence

Objective 1: Identify the structure and function of a DNA molecule. 1. Students should be able to label the parts of a nucleotide and understand function of DNA 2. Understand the concept of base pairing as it relates to the double helix structure of DNA 3. Describe the difference between nuclear and mitochondrial DNA 4. Contrast DNA strands that code for the production of proteins with strands that contain

repeating base sequences (ie exons and introns, SNPs)

Objective 2: Describe the procedures for obtaining biological samples and how they are used in criminal law.

1. List the necessary procedures for proper preservation of biological evidence for laboratory DNA analysis

2. Understand how CODIS is used in criminal investigations 3. Understand what prompted the Innocence Project and what it does today

Objective 3: Describe advancements in technology used to obtain a DNA fingerprint. 1. Explain the technology of PCR and gel electrophoresis and how it applies to forensics DNA

typing 2. Contrast the newest DNA typing technique, STRs with previous DNA technology 3. Be able to match SNPs from suspects to those found at a crime scene in a simulated lab

experience

Key Terms:

Deoxyribonucleic Acid (DNA)

Complimentary Base Pairing

Mitochondrial DNA (mtDNA)

Nucleotide

Substrate Control

Buccal Cells

Epithelial Cells

Sequencing

Polymerase Chain Reaction (PCR)

Primer

Restriction Fragment Length

Polymorphisms (RFLP)

Gel Electrophoresis

Restriction Enzymes

DNA Ladder

Short Tandem Repeats (STR)

Y-STR

Loci

Nuclear DNA

2

DNA Evidence Unit

Date Topic

2/25 Structure and Function of DNA Notes and The Double Helix Movie

2/26 DNA Extraction Lab

2/27 Introduction to DNA Analysis: DNA Typing Annotated Reading

2/28 Introduction to RFLP’s and Gel Electrophoresis Notes and RFLP Simulation

3/1 Who Killed Rockina? Lab

3/4 Gel Electrophoresis-Hector’s Dolphin Lab

3/5 Introduction to STR’s and STR Case Study

3/6 Finish STR Case Study

3/7 Who Dun It? STR Lab

3/8 911 Case Study and Annotation

3/11 Unit Review

3/12 DNA Evidence Unit Multiple Choice Test

3/13 Guest Speaker

3/14 DNA Evidence Unit Performance Assessment

3/15 DNA Evidence Unit Performance Assessment

2/25/19

Objective: Students will be able to describe the basic structure of DNA and how it is collected at a crime

scene.

Warm-Up:

1. What are two things that I want you to know by the end of this unit?

2. When is your unit test?

Structure of DNA

What is DNA?

Stands for: _______________________________

Carries our genetic material from one generation to the next in ______________

DNA is arranged in a ___________________ -two strands are twisted around each other like a

winding staircase.

If you unwind a single human chromosome of DNA, it will be about ___________

What does our DNA do?

Only about ___________________________________ is made up of our genes.

Up until recently, scientists believed that the rest of our DNA was noncoding-they thought these

sequences were “_________”!

However, a research project called Encode studied these sections and found:

o Parts of the DNA that don’t code for genes contain about ______________

__________________________________________________________:

3

Determine when the gene turns on and off

_____________________________________________________

Switches for a variety of diseases

Affects every cell, but can do so at different times in our lifetime

Can be sequenced and used for identification purposes in crime cases

Examples:

• Instructions for the cells to be different types of cells (brain cell vs liver

cell)

• Instructions for pancreas cell to make insulin after a meal

• Instructions for cells to reproduce to replace dead or damaged cells (like

skin cells replacing those that sloughed off).

Structure

Nucleic Acids: ____________________________________________________

________________________________________________________________

o Nucleotides are made up of 3 things:

A phosphate group (same on all nucleotides)

5 Carbon sugar molecule (same on all nucleotides)

_____________________________ (Different on each nucleotide)

Adenine (A) (__________________: 2 rings of

Guanine (G) Carbon and Nitrogen)

Thymine (T) (__________________: single ring of

Cytosine (C) Carbon and Nitrogen)

o The phosphate of one nucleotide is attached to the sugar of the next nucleotide with a

__________________________ (strong)

o The base pairs on each strand of DNA are bound together with ________

______________ (weak)

Base pairing:

Purines are always paired with Pyrimidines

o __________ always pairs with _____________ (forms 2 hydrogen bonds)

o ___________ always pairs with ___________ (forms 3 hydrogen bonds)

This is called ___________________________-the sequence on one strand determines the

sequence on the other.

DNA has a direction-it is polar! We call the strands anti-parallel

o It goes from the 5’ end to the 3’ end.

o The opposite strand also goes from the 5’ to the 3’ end,

4

Mitochondrial DNA

The in our cells also contains its own DNA (mtDNA) that tells the

mitochondria what to do and how to replicate.

Mitochondrial DNA comes from our

o This is because the portion of sperm that is able to penetrate the egg does not contain

mitochondria.

Mitochondrial DNA is much more than nuclear DNA and therefore might

be to find and analyze at a crime scene.

However, since the DNA comes from our mother, it is in all children

produced by the same woman.

Collection of Biological Materials

Arriving at a Crime Scene

When biological materials are found at a crime scene, the first step is to

the investigator and the sample from by taking precautionary

measures.

A scientist should always assume that biological materials are contagious and should wear the

following protective gear:

o Latex or Nitrile Gloves

o Face Mask

o Boot Covers

o Eye Protection

o Lab coat/Coveralls

Once the investigator has on the proper protective gear, and

sketches of the blood should be taken at the scene.

A substrate control should also be collected at the scene.

o A is a piece of the material that is close to but not

part of the biological material being collected.

Collecting Evidence

Possible sources of DNA:

o Blood

o Semen

o Sweat

o Skin

o Saliva

5

o Buccal swabs: a swab is used to collect cheek cells out of your mouth

Collecting DNA Samples:

o Biological materials should be placed in a or well

ventilated box to discourage the growth of bacteria.

o Dried blood is swabbed with a that has been dipped in

distilled water. The Qtip then goes into a well ventilated for transport.

o that contains blood is packaged in an airtight container

and immediately . This is to discourage the growth of

bacteria that is naturally in the soil.

Types of DNA Analysis

DNA Analysis Techniques

Before any analysis can be done, the DNA sample has to be amplified, or copied, through a

process called Polymerase Chain Reaction ( ).

After enough of the sample is created, we can use one of the two techniques to analyze the

sample.

o Restriction Fragment Length Polymorphism ( ): a sample of DNA is separated

using gel electrophoresis based on the size of the DNA fragments.

o Short Tandem Repeats ( ): looks at the non-coding part of our genome and

counts how many times a specific sequence of nucleotides repeats.

2/26/19

Objective: Students will be able to extract DNA from wheat germ and observe it with the naked eye.

Warm-Up:

1. Where is DNA located in a cell? What are the barriers that you must get through in order to

remove DNA from a cell?

2. Why is protective wear necessary when collecting biological evidence from a crime scene?

3. Why do we want to inhibit the growth of bacteria when collecting blood from a crime scene?

Vocabulary Scramble: use the definition to unscramble the vocabulary word. Then, draw a picture of

the word. (5 words on the next page)

Word Scramble Definition Picture

oucdlnetie The components of this monomer are: phosphate, sugar, and a nitrogen base.

oetmplnyimcar sabe aiipngr

A-T and C-B, therefore the sequence on one strand determines the sequence on the paired strand.

6

itdohocalmnri adn

This type of DNA is passed down from the mother only and is found outside the nucleus of the cell.

uclcba Cheek cells

ecuesgnqin A procedure used to determine the order of the base pairs that make up a DNA molecule.

utbestrsa ronlcto

A piece of the material that is close to but not part of the biological material being collected and is used for comparison.

palheiteli Skin cells.

2/27/19

Objective: Students will be able to explain the technology of PCR and gel electrophoresis and how it

applies to forensics DNA typing.

Warm-Up:

Read pages 369-371 in the textbook and answer the following questions.

1. What are the steps of DNA replication?

2. What enzyme proofreads the growing DNA for mismatched pairs?

3. Why was PCR a huge advancement in the field of DNA analyzation?

Read pages 382-384 and answer the following questions.

1. What enzyme starts the process of PCR?

2. How many times can a strand of DNA be amplified by PCR?

3. Fill in the chart about the specifics of PCR.

Temperature (⁰C) Enzymes Used What is happening?

94

60

72

7

2/28/19

Objective: Students will be able to explain the technology of PCR and gel electrophoresis and how it

applies to forensics DNA typing.

Warm-Up:

1. How are nuclear DNA and Mitochondrial DNA similar? How are they different?

2. What is an advantage to processing mitochondrial DNA rather than nuclear DNA from a crime

scene? What is a disadvantage?

PCR and RFLP’s

Polymerase Chain Reaction (PCR)

A method of making of a piece of DNA.

o It takes about 3 hours to make 1 billion copies of a single DNA molecule.

You need:

o sample to amplify

o Many copies of 2 specific olignoculeotide

These primers are synthetically made and are specific to the section of DNA you

wish to copy.

o DNA

o : “Taq DNA Polymerase”

Found in geysers of Yellowstone National Park

Steps in Copying DNA

1. A DNA molecule is placed in a small .

2. Taq DNA polymerase, , and nucleotide base are added.

3. The DNA is -usually to around 90 C.

a. This breaks the hydrogen bonds between the two strands of DNA so they

are .

4. The temperature is to about 55 C

a. This allows the specific to bind to the DNA strand at the appropriate

sequence.

b. The primers act like bookends-only the DNA sequence the primers

will be .

5. The temperature is again to around 70 C.

a. This allows the Taq DNA polymerase to new bases to the separated strands.

6. The cycle is repeated many times over the next few hours to create many copies of the DNA.

8

Restriction Fragment Length Polymorphism (RFLP)

Restriction enzymes are used to “ ” the strand of DNA at a specific nucleotide

sequence.

o Each person has unique DNA and therefore, the location of the specific sequence will be

different for each person.

o The result is many of DNA that are all different .

We can use a technique called to separate these fragments

and analyze the DNA.

Uses:

o Genome mapping, localization of genetic disease genes, determination of risk for a

disease, genetic fingerprinting (who does the DNA belong to), and paternity testing.

Gel Electrophoresis

What is it?

A method used to and analyze DNA, RNA and proteins based on their size

and charge.

o The phosphate groups are charged so they will be attracted to the

positive electrode.

How does it Work?

1. is added to a container hooked up to an electric current generator.

2. Samples of the DNA, RNA, or protein are added to the at one end of the gel.

3. The is turned on.

4. are pulled through the gel in ladders based on their .

a. particles move father than large particles and are found near

the .

b. Negative DNA moves toward the positive electrode.

5. is used to stain the material based on what you want to see.

How to Read a Gel

The sample in each well will separate into well defined “lines” of DNA. Each line is called

a .

o Each band contains a large number of DNA fragments of the

that have all traveled as a group to the same position.

Together, all the bands are called a .

We can compare the DNA ladder of each sample to a slot that

contains fragments of a .

We can also compare the different bands to each other to get a “ ”

3/1/19

Objective: Students will be able to explain the technology of PCR and gel electrophoresis and how it

applies to forensics DNA typing.

9

Warm-Up:

These are the results of a DNA test from a crime scene.

1. Circle the smallest fragment in the control ladder. Box the largest fragment in the control

ladder.

2. Highlight the alleles in sample 2 that match the victim.

3. Is the suspect guilty of the crime? Explain how you know.

Vocabulary Dice

Roll two dice. The first dice tells you the vocabulary word. The second dice tells you the task. Switch

back and forth with your partner until the teacher calls time.

Vocabulary Words

1. PCR 2. Primer 3. RFLP 4. Gel Electrophoresis 5. Restriction Enzymes 6. DNA Ladder

Activity

1. Give the definition in your own words. 2. Draw a picture of the word. 3. Pair the word with another vocabulary

word and explain why you paired them together.

4. Give an example of the word. 5. Use the word in a sentence. 6. Explain how you are going to remember

the word.

3/4/19

Objective: Students will be able to describe the process of PCR and identify an unknown sample by

mimicking how an enzyme will cut the DNA and how it will travel through the agros gel in gel

electrophoresis.

Sample 1 is the victim’s DNA.

Sample 2 is a sample collected from

the crime scene. It is a mixture of the

victim’s DNA and the killer’s DNA.

Sample 3 is the suspect’s DNA.

Sample 4 is the control.

10

Warm-Up:

Mr. and Mrs. Smith just gave birth to fraternal

twins-Bob and Jane. Unfortunately, a fire alarm

caused the entire nursery to evacuate the building.

Six children were on their way to their parents and

were carried out of the building in the arms of

nurses. When the parents, children, nurses, and

doctors were allowed back into the building, they

discovered that they weren’t sure which child

belonged to who. The doctor took DNA samples

from Mr. and Mrs. Smith and the six unknown

children. Use the gel results to answer the questions.

1. Which of the six children are Mr. and Mrs. Smith’s twins? How do you know?

2. What do the bands in the gel represent?

3. How does the DNA get fragmented?

3/5/19

Objective: Students will be able to explain the technology of Short Tandem Repeats and how it applies

to forensics DNA typing.

Warm-Up:

Read pages 374-381 and answer the following questions.

1. Define RFLP in your own words.

2. How is electrophoresis used with these fragments?

3. Briefly describe the process of gel electrophoresis.

4. What distinction does RFLP DNA typing have? (pg 380)

5. What is the significance of the dress on page 381?

11

Short Tandem Repeats

DNA Identification

99% of each human’s DNA is indistinguishable

Yet, no two people (except identical twins!) share exactly the same arrangement of base pairs

What are STR’s?

Looking at the intron region of DNA

o The coding part of the DNA tells our bodies what to do so it is the for

most individuals.

o We call these regions variable number of tandem repeats ( )

o The VNTR’s are in common locations on a set chromosome. We call these locations loci.

We get one set of chromosomes from so the number of STR’s will be

different on each chromosome.

o So each STR has numbers!

o Although siblings with the same parents get their genes from the same “gene pool”,

crossing over allows for a unique set of genes in each person.

Repeats are bp long (for example: CTTG-4bp)

3 to 100+ repeats arranged head-to-tail (CTTGCTTGCTTGCTTGCTTG…)

The number of repeats in a row in the population.

Y STR’s

Short Tandem Repeats found on the

o These are passed down through the paternal side and there is very little variation from

generation to generation.

Used for:

o -since females don’t have a Y chromosome, if

there is one present, it has to come from a male

o Used to distinguish between

o Ancestry Testing for Males

Analyzing STR’s

1. Locate a sample to test.

2. Use to amplify the desired DNA sequence.

3. Use to separate the different lengths of STR’s.

4. Compare the of STR’s in each loci to known samples to determine a match.

Results

We use STR loci to evaluate a DNA sample.

The more STR’s at a given loci that are the same, the more the sample

came from that .

o It is common to share the same number of STR’s at 1 or 2 loci

12

Reading Results

2 ways:

o A computerized

o A with the loci across the top and the number of repeats at each loci

Remember-you have two of each chromosome so you will have 2 numbers for

each loci.

3/6/19

Objective: Students will be able to contrast the newest DNA typing technique, STR’s, with previous DNA

technology (RFLP) and be able to match SNP’s from suspects to samples found at a crime scene in a

simulated lab experience.

Warm-Up:

Read pages 384-388 and answer the following questions.

1. Explain what STR’s are.

2. What are two advantages for using STR’s?

3. How many CODIS STR’s are there?

4. What does this tell forensic scientists and how accurate is it?

Read pages 390-392 and answer the following questions.

1. How is sex identification done using STR’s?

2. Is DNA typing becoming acceptable as truth in courts?

13

3/7/19

Objective: Students will be able to contrast the newest DNA typing technique, STR’s, with previous DNA

technology (RFLP) and be able to match SNP’s from suspects to samples found at a crime scene in a

simulated lab experience.

Warm-Up:

Karen has four children: three daughters (Tiffany, Melissa, and Amanda) and one son (Steve).

1. Predict the STR’s for Steve using the table below. Remember, you get one chromosome from

each parent.

2. A body was found in the woods and forensic scientists have the following DNA data for the

missing person. Is this person Steve? Why or why not?

STR Body STR Body STR Body

D3S1358 16,18 D18S51 18,18 TPOX 8,10

vWA 17,18 D5S818 11,12 CSF1PO 12,12

FGA 22,24 D13S317 8,8

AMEL XX D7S820 9,10

D8S1179 13,15 D16S539 12,12

D21S11 28,28 THO1 8,9

14

3/8/19

Objective: Students will be able to apply their knowledge of DNA, PCR, Gel Electrophoresis and the two

different analyzation techniques (RFLP and STR) to a real-life case study.

Warm-Up:

The 15-STR locus DNA profile of a missing person, James Dittman, is given in the following table.

STR Loci Allele

D3S1358 15

THO1 6, 9.3

D21S11 27

D18S51 15, 16

PENTA E 10

D5S818 11

D13S317 10, 13

D7S820 9, 10

D16S539 11, 12

CSF1PO 13

PENTA D 12, 13

AMELOGENIN XY

vWA 17, 19

D8S1179 10, 13

TPOX 8, 12

FGA 21

Decomposing remains were found deep in the woods near the missing person’s house. DNA from these

remains was extracted, amplified, and analyzed at 15 STR loci. Compare the resulting STR readout to

determine whether the remains could belong to James Dittman. If not, at which STR loci do the profiles

differ?

Vocabulary Builder

Define the following vocabulary words. Then, write a sentence using the word but instead of writing the

word, draw a picture in its place.

EXAMPLE Word: Noble Gases Definition: The elements in group 8A or 18 including Helium, Neon, Argon, Krypton, Xenon, and Radon.

Sentence: The are called noble because they contain 8 valence electrons and do not react with other elements.

15

Word: STR Definition: Sentence:

Word: Y-STR Definition: Sentence:

Word: Loci Definition: Sentence:

Word: Nuclear DNA Definition: Sentence:

3/11/19

Objective: Students will be able to demonstrate their knowledge of DNA and analyzation techniques on

a unit review.

Warm-Up:

1. Go back to the front page of this packet and read through the essential outcomes. Put a

question mark next to the topics that you still have questions about. Put a check mark next to

the topics that you feel confident about.

2. How are you going to go about learning those topics that have a question mark next to them?

3/12/19

Objective: Students will be able to demonstrate their knowledge of DNA and analyzation techniques on

a unit test.

Warm-Up:

1. None

3/13/19-Guest Speaker

16

3/14/19

Objective: Students will be able to describe the components of blood and how it is used to analyze a

crime scene.

Warm-Up:

1. None

3/15/19

Objective: Students will be able to demonstrate their knowledge of DNA and analyzation techniques on

a unit test.

Warm-Up:

1. Turn your work into the basket.