1 Population Genomics Gil McVean, Department of Statistics, Oxford.

Population Genomics

Gil McVean, Department of Statistics, Oxford

Questions about genetic variation

• How different are our genomes?

• How is the variation distributed within and between genomes?

• What does variation tell us about human evolution?

How different are our genomes?

Serological techniques for detecting variation

Rabbit

A B AB O

Blood group systems in humans

• 28 known systems– 39 genes, 643 alleles

System Genes Alleles

ABO ABO 102

Colton C4A, C4B 7+

Chido-rodgers AQP1 7

Colton DAF 10

Diego SLC4A1 78

Dombrock DO 9

Duffy FY 9

Gerbich GYPC 9

GIL AQP3 2

H/h FUT1, FUT2 27/22

I GCNT2 7

Indian CD44 2

Kell KEL, XK 33/30

Kidd SLC14A1 8

Knops CR1 24+

Landsteiner-Wiener

ICAM4 3

Lewis FUT3, FUT6 14/20

Lutheran LU 16

MNS GYPA,GYPB,GYPE

OK BSG 2

P-related A4GALT, B3GALT3

RAPH-MER2 CD151 3

Rh RHCE, RHD, RHAG

Scianna ERMAP 4

Xg XG, CD99 -

YT ACHE 4

http://www.bioc.aecom.yu.edu/bgmut/summary.htm

Protein electroporesis

• Changes in mass/charge ratio resulting from amino acid substitutions in proteins can be detected

• In humans, about 30% of all loci show polymorphism with a 6% chance of a pair of randomly drawn alleles at a locus being different

--- - --

++--- - --- - +

Starch or agar gel

Direction of travel

Lewontin and Hubby (1966)

Harris(1966)

The rise of DNA sequence analysis

• RFLPs– Cann et al 1987

• Sequencing of small regions– Vigilant et al 1991

• Whole genome sequencing– Ingman et al 2000

The human genomes…

• The draft human genome sequence was published in 2001– This is a mosaic from several individuals

• Since then, several more genomes have been sequenced, at least partially– Shotgun sequencing variation discovery

• Other methods have been developed to look for gross chromosomal differences

Nimblegen array CGH

The International HapMap Project

• Launched in 2002 with the goal of characterising single nucleotide variation between 540 human genomes from individuals of European, Nigerian, Chinese and Japanese ancestry

• Not a sequencing project, rather it types known polymorphisms

• Has currently assembled information on over 6 million SNPs (single nucleotide polymorphisms)

The 1000 Genomes Project

How do we differ? – Let me count the ways

• Single nucleotide polymorphisms– 1 every few hundred bp

• Short indels (=insertion/deletion)– 1 every few kb

• Microsatellite (STR) repeat number– 1 every few kb

• Minisatellites– 1 every few kb

• Repeated genes– rRNA, histones

• Large inversions, deletions– Y chromosome, Copy Number Variants (CNVs)

TGCATTGCGTAGGCTGCATTCCGTAGGC

TGCATT---TAGGCTGCATTCCGTAGGC

TGCTCATCATCATCAGCTGCTCATCA------GC

≤100bp

Y chromosome variation

• Non-pathological rearrangements of the AZFc region on the Y chromosome

Tyler-Smith and McVean (2003)

Mutation is the ultimate source of variation

• New mutations occur in the germ-line

• Point mutations at about 2x10-8 per nucleotide per generation– You pass on about 60 new mutations to your children, of which perhaps 1

changes the protein sequence encoded by a gene

• Microsatellite mutations can occur much faster– Up to 10-4 per generation– Some, e.g. in Huntington’s disease, have important consequences

• Minisatellites can mutate at rates of up to 10-1 per generation– The uniqueness of these patterns gives rise to DNA fingerprinting

• Most of the differences between genomes are the result of inheriting mutations from our ancestors

Our genomesInherited mutations

Our genealogical tree

Mutations in our ancestors

Different, but not that different

• Humans are one of the least diverse organisms (excepting cheetahs)

Species Diversity (percent)

Humans 0.08 - 0.1

Chimpanzees 0.12 - 0.17

Drosophila simulans 2

E. coli 5

HIV1 30

Photos from UN photo gallery www.un.org/av/photo

An aside on the genetics of race

• It is sometimes claimed that there is a ‘genetic basis to race’

• What is true is that groups of individuals from different parts of the world tend to have similar genomes because they share recent ancestry

• But there are very few ‘fixed’ genetic differences between populations (I can think of one example – the FY gene)

• The differences between populations are in terms of the combinations of variants,

Rosenberg et al (2002)

How is genetic variation distributed within and between genomes?

Diversity is not evenly distributed across the genome I

Genome Average pairwise differences / kb

Relative copy number ()

Autosomes 0.5 – 0.85 1

X chromosome 0.47 3/4

Y chromosome 0.15 1/4

mtDNA 2.8 1/4

TISMWG (2001) , Jobling et al (2004)

• Autosomes, sex chromosomes and mtDNA have systematically different levels of diversity

• This reflects differences in the number of chromosomes and the mutation rate

Diversity is not evenly distributed across the genome II

TISMWG (2001)

Chromosome 6

• There are fluctuations in the level of variation across the genome

Diversity is not evenly distributed across genes I

• Purifying selection eliminates deleterious mutations and reduces diversity in regions of strong functional constraint

0123456789

Intergenic Intronic Exonic UTR

Zhao et al (2003)

Diversity is not evenly distributed across genes II

• Adaptive evolution ‘wipes out’ diversity nearby due to the hitch-hiking effects of a selective sweep

– e.g. Duffy-null locus in sub-Saharn africa, protects against P. vivax